| SnpEff Available Databases |
java -jar snpEff.jar databases Genome |
This command provides a list of configured databases, i.e. available in snpEff.config file. |
| FreeBayes |
freebayes [OPTION] ... [BAM FILE] ... |
FreeBayes is a Bayesian genetic variant detector designed to find small polymorphisms, specifically SNPs (single-nucleotide polymorphisms), indels (insertions and deletions), MNPs (multi-nucleotide polymorphisms), and complex events (composite insertion and substitution events) smaller than the length of a short-read sequencing alignment. |
| bcftools view |
bcftools view [options] <in.vcf.gz> [region1 [...]] |
This tool converts BCF files into VCF files using BCFtools view from the SAMtools set of utilities. |
| REDItoolKnown.py |
REDItoolKnown.py -i rnaseq.bam -f reference.fa -l knownEditingSites.tab |
REDItoolKnown.py has been developed to explore the RNA editing potential of RNA-Seq data sets using known editing events. Such events can be downloaded from DARNED database or generated from supplementary materials of a variety of publications. Known RNA editing events have to be stored in TAB files (see above for details). |
| REDItoolDenovo.py |
REDItoolDenovo.py -i rnaseq.bam -f reference.fa |
REDItoolDenovo.py has been conceived to predict potential RNA editing events using RNA-Seq data alone and without any a priori knowledge about genome information and biological properties of RNA editing phenomenon. |
| GEMINI de_novo |
gemini de_novo --columns "chrom,start,end" test.de_novo.db |
You can use this tool for identifying de novo (a.k.a spontaneous) mutations that arise in offspring. |
| REDItoolDnaRna.py |
REDItoolDnaRna.py -i rnaseq.bam -j dnaseq.bam -f myreference.fa -o myoutputfolder |
REDItoolDnaRna.py is the main script devoted to the identification of RNA editing events taking into account the combined information from RNA-Seq and DNA-Seq data in BAM format. To look at potential RNA editing candidates, RNA-Seq data alone can be used. |
| samtools mpileup |
samtools mpileup [-EBugp] [-C capQcoef] [-r reg] [-f in.fa] [-l list] [-Q minBaseQ] [-q minMapQ] in.bam [in2.bam [...]] |
Report variants for one or multiple BAM files. Alignment records are grouped by sample identifiers in @RG header lines. If sample identifiers are absent, each input file is regarded as one sample. |
| REDItoolBlatCorrection.py |
REDItoolBlatCorrection.py -i rnaseq.bam -f reference.fa -F reference.2bit -o BlatCorrection -V -T |
REDItoolBlatCorrection.py requires gfServer and gfClient programs from Blat package . Reference fasta file can be converted in .2bit format using the utility faToTwoBit. |
| VarScan |
java -jar VarScan.jar pileup2snp [pileup file] OPTIONS |
Call SNPs from a pileup file based on user-defined parameters |
| selectPositions.py |
selectPositions.py -i unselected_positions.txt -o selected_positions.txt |
selectPositions.py can filter an output REDItool table according to different criteria. |
| GEMINI set_somatic |
gemini set_somatic --min-depth 30 --min-qual 20 --min-somatic-score 18 --min-tumor-depth 10 --min-norm-depth 10 tumor_normal.db |
Flag somatic variants. |
| FilterTable.py |
FilterTable.py -i mytable -s dbsnp137.gtf.gz -S snp -o mytable_filtered -E -p |
FilterTable.py filters positions of a input table according to specific annotations indexed by tabix tool. Filtered out positions will be marked with “#†at the beginning of each line. To exclude such lines the option -E should be used. Features are the same as indicated in the third field of GTF annotation file. |
| vg |
vg align -s CTACTGACAGCAGAAGTTTGCTGTGAAGATTAAATTAGGTGATGCTTG x.vg |
If it is a small graph, you could align to it using a full-length partial order alignment |
| SnpEff Download |
java -jar snpEff.jar download -v WBcel215.69 |
This command downloads and installs a database. |
| GEMINI mendel_errors |
gemini mendel_errors --columns "chrom,start,end" test.mendel.db --gt-pl-max 1 |
Identify non-mendelian transmission |
| GEMINI windower |
gemini windower -w 50000 -s 0 -t nucl_div -o mean my.db |
Conducting analyses on genome “windowsâ€. |
| Varscan |
java -jar VarScan.jar [COMMAND] [OPTIONS] |
VarScan performs variant detection for massively parallel sequencing data, such as exome, WGS, and transcriptome data. It calls variants from a mpileup dataset and produces a VCF 4.1 |
| GEMINI actionable_mutations |
gemini actionable_mutations tumor_normal.db |
This tool reports actionable mutations as well as their known drug interactions (if any) from DGIdb. |
| GEMINI load |
gemini load -v my.vcf -p my.ped my.db |
Loading a VCF file into GEMINI |